Frequency of BCR-ABL gene fusion (p190) in a cohort of patients diagnosed with acute lymphoblastic leukemia

Frequency of BCR-ABL gene fusion (p190) in a cohort of patients diagnosed with acute lymphoblastic leukemia

• Autor
• Marcelo Braga de Oliveira
• Co-autores
• Vitória Beatriz de Jesus Viana , Lucas Brabo Rotella , Ágatha Tereza Miranda Tavares , Abigail Nayara dos Santos Silva , Fernando Augusto Rodrigues Mello Junior , Laudreísa da Costa Pantoja , Alayde Vieira Wanderley , André Salim Khayat
• Resumo

• Introduction: Acute lymphoblastic leukaemia (ALL) is a heterogeneous disease at the demographic, clinical and genetic levels. It is a more common disease in children with an average age between 3 and 6 years, but it can appear in other age groups, and about gender, its incidence occurs in male patients compared to female patients. Risk factors include sex, age, white blood cell count, and immunophenotype (B-cells/T-cells). Furthermore, cytogenetic and molecular abnormalities have been identified as playing a key role in its pathogenesis. Thus, gene fusions are genetic variants that contribute to tumorigenesis, in which there is a certain correlation with the clinical course of the disease. The detection of the type of gene fusion is a differential in the diagnosis of ALL, as it provides molecular markers that guide targeted therapy and monitoring of minimal residual disease. Therefore, chromosomal translocations found in B-cell ALL define distinct clinicopathological subgroups and have been used in risk stratification for treatment purposes, one of the main ones being the BCR-ABL1 (t9;22) fusion. The presence of the Philadelphia chromosome (Ph+), generated by the fusion above, is fundamental for the management of ALL, as it is the cytogenetic aberration with the most significant impact on the prognosis and treatment of the patient. These patients have implications both in terms of prognosis and treatment. Historically, their 1-year survival is around only 10%. Therefore, there is a great need to obtain the status of this translocation in all patients before starting therapy. Objective: The present study aimed to evaluate the frequency of the number of patients diagnosed with ALL presenting the BCR-ABL1 fusion. Material and Methods: The ribonucleic acid extraction was performed using the TRIzol® protocol. Then, the conversion to cDNA was carried out using the High Capacity® kit. The methodology was performed by Polymerase Chain Reaction (PCR), and 6.25 µL of GoTaq, 4.25 µL of water, and 0.5 µL of each primer, forward (CAACAGTCCTTCGACAGCAG - BCR) were used for the reaction mix. and reverse (ACACCATTCCCCATTGTGAT - ABL), and 1 µL of the sample. Thermocycling was performed with 35 cycles at temperatures of 95°C for denaturation, 60°C for annealing and 72°C for an extension. In the end, runs were performed on 1% agarose gel for 45 minutes to verify the existence of amplified bands, indicative of positivity for the evaluated fusion. Results: The “n” sample of the study corresponded to 122 patients newly diagnosed with ALL, and of this total, 29 patients were positive for the BCR-ABL fusion, where the mean age of these patients was 9 years, about sex, 18 patients are male and 11 are female. Conclusion: Therefore, fusion screening provides important information for the oncologist, who can infer the patient's unfavourable prognosis, in addition to adjusting the treatment by adding a tyrosine kinase inhibitor to chemotherapy, which increases the chance of leukaemia going into remission.

• Palavras-chave
• BCR-ABL, gene fusion, ALL
• Área Temática
• Pós-graduação